Clients¶
Swagger¶
“Swagger is a specification and framework implementationfor describing, producing, consuming, and visualizing RESTful web services.”
Creating new clients is easy when you use the swagger.yaml and Swagger autogeneration. You can autogenerate clients using the Swagger editor or by locallying running the Swagger autogeneration tools. I’ll go through the steps for creating a new client using the GFE service swagger.yaml and the Swagger editor.
- Go to the Swagger editor.
- Import the GFE service swagger.yaml by either pasting the text or by clicking File and then Import URL. Import the URL for the raw text of the swagger.yaml.
- Click on Generate Client and then select the language you would like to use.
R Client¶
Note
The R client hasn’t been updated yet to include the nextflow APIs. Open the GfeClient.R script in the client-R directory to see all of the available functions.
The R client is available in the client-R directory in the github repositiory. Here are a few examples of installing and using the R client:
if (!is.installed('gfeClient')){
library(devtools)
install_github('nmdp-bioinformatics/service-gfe-submission/client-R')
}
library('gfeClient')
host <- 'http://gfe.b12x.org/'
# Get GFE from fasta file
fasta.file <- 'GFE_Submission/t/resources/fastatest1.fasta'
fasta.gfe <- fasta2gfe(host,'HLA-A',fasta.file)
# Get sequence from
seq <- gfe2seq(host,'HLA-A','HLA-Aw1-1-7-20-10-32-7-1-1-1-6-1-5-3-5-1-1')
# Get GFE from sequence
gfe <- seq2gfe(host,'HLA-A',seq)
# return detailed logs
verbose <- 1
gfe <- seq2gfe(host,'HLA-A',seq,verbose)
# Return structure (ex. exon, 1 , TGCCCAAGCCCCTCACCCTGAGATGGG)
structure <- 1
gfe <- seq2gfe(host,'HLA-A',seq,verbose,structure)
Perl Client¶
The perl client is available in the client-perl directory in the github repositiory. Here are a few examples of installing and using the perl client:
#!/usr/bin/env perl
use strict;
use warnings;
use GFE_Client;
my $s_seq = shift @ARGV;
my $s_locus = shift @ARGV;
# Does alignment of sequence and submission of aligned
# sequence to the GFE service.
my $o_client = GFE_Client->new();
my $rh_gfe = $o_client->getGfe($s_locus,$s_seq);
# Print out GFE
print $$rh_gfe{gfe},"\n";